standard control morpholino  (Gene Tools Inc)

Journal: Nature Communications

Article Title: Increasingly efficient chromatin binding of cohesin and CTCF supports chromatin architecture formation during zebrafish embryogenesis

doi: 10.1038/s41467-025-56889-5

Figure Lengend Snippet: a Schemes of time-lapse illumination alternated with continuous intervals (TACO). Molecules are classified in short and long-bound binding classes comparable to ITM (Fig. ) and analyzed during continuous intervals (dark green and dark red bars, see Methods). b Mean jump distances of HT-Rad21 molecules classified as short bound (circles) and long bound (squares) at different developmental phases. pre-ZGA (red): 64-, 128-, 256, 512-cell stages pooled; post-ZGA (green): high, oblong, sphere stages pooled; shield stage (blue) and shield stage with the addition of nibpl-morpholino (MO, cyan). Insets: example tracks. Data represent mean ± s.d. P -values were calculated using a two-sided Kruskal-Wallis test followed by Dunn’s multiple comparison test and Multiple Mann-Whitney test with a false discovery rate set to 1% (see p -values in Supplementary Table and statistics in Supplementary Table ). Scale bar: 1 µm. c Sketch of cohesin-mediated decrease in chromatin motion. d Left: Example nucleus (bold white circle) subdivided into five bins (dotted lines) with the initial positions of long-bound HT-Rad21 tracks (pink). Right: Pooled initial positions of long-bound tracks of all ITM- and TACO measurements at pre-ZGA stages shown in a unit circle. For post-ZGA and shield stage, see Supplementary Fig. . e HT-Rad21 track counts per radial bin (compare panel ( d ), right) normalized to bin area and the highest bin value. Data represented as value ± statistical error (square root of track counts per bin). Statistics are provided in Supplementary Tables and . CBD Center-Border-Distance. Source data are provided as a Source Data file for Fig. 2b, e.

Article Snippet: Negative control measurements were performed by coinjection of 4 ng standard control morpholino mRNA obtained from Gene Tools LLC (Philomath, USA).

Techniques: Binding Assay, Comparison, MANN-WHITNEY

Journal: bioRxiv

Article Title: H3K4 methylation-promoted transcriptional memory ensures faithful zygotic genome activation and embryonic development

doi: 10.1101/2025.01.20.633863

Figure Lengend Snippet: Cxxc1 and Kmt2b are required for proper ZGA and embryonic development. (A) Gene expression levels of cxxc1.L and cxxc1.S at stages of development (Session et al., 2016). (B) Gene expression levels of kmt2b.L and kmt2b.S at stages of development (Session et al., 2016). (C) Western blots showing Cxxc1 and Kmt2b protein levels in Cxxc1 and Kmt2b knockdown embryos. (D) Count of differentially expressed genes at 5.5hpf, 6.5hpf and 7.5hpf time points in Cxxc1 and Kmt2b morpholino-injected conditions compared to control morpholino embryos (adj. p-value < 0.05). (E) Overlap of downregulated zygotic genes at any timepoint between Cxxc1 and Kmt2b morpholino conditions compared to control morpholino. (F) Overlap of downregulated genes compared to control morpholino at any timepoint between both biological replicates. (G) Number of differentially expressed and unchanged zygotic genes at 5.5hpf, 6.5hpf and 7.5hpf time points in Cxxc1 and Kmt2b morpholino-injected conditions compared to control morpholino embryos in biological replicate 2 (adj. p-value < 0.05). Zygotic genes = Gamete-Zygotic (GZ) + Zygotic-Specific (ZS). (H-I) Fold-change of gene expression levels of all zygotic genes in each group calculated over mean TPM of control morpholino technical replicates for (H) KEPT and (I) GAINED groups at the three time points in biological replicate 2. Statistical test: one-sided Wilcoxon rank-sum test; p-values: (****)<=0.0001, (***)<=0.001, (**) <= 0.01, (*)<=0.05; n.s. are p-values > 0.05. (J) Expression of zygotic genes in 3 technical replicates of every sample, clustered by H3K4me3 dynamics group (KEPT, GAINED and ABSENT) for biological replicate 2. Fold-change of every gene is calculated over mean TPM of three technical replicates of control morpholino of the respective time point. Genes are annotated by differential gene expression, and RNA dynamics group. (K) Gene ontology analysis of downregulated zygotic genes from . (L) Representative phenotype images of embryos for each condition at NF41. n=2 experiments, N>35 per condition.

Article Snippet: The recommended standard control morpholino from Gene Tools LLC was used as a control.

Techniques: Expressing, Western Blot, Knockdown, Injection, Control

Journal: bioRxiv

Article Title: H3K4 methylation-promoted transcriptional memory ensures faithful zygotic genome activation and embryonic development

doi: 10.1101/2025.01.20.633863

Figure Lengend Snippet: Cxxc1 and Kmt2b are required for proper ZGA and embryonic development. (A) Illustration of experimental setup. (B) Western blot showing H3K4me3 levels in Cxxc1 and Kmt2b knockdown embryos compared to non-injected control and control morpholino-injected embryos at post-ZGA (st12). (C) Overlap of downregulated zygotic genes at any timepoint between Cxxc1 and Kmt2b morpholino conditions compared to control morpholino. (D) Volcano plots displaying expression fold-change and adj. p-value (cutoff: 0.05) in knockdown conditions compared to control morpholino at each timepoint colored by RNA dynamics groups. (E) Number of differentially expressed and unchanged zygotic genes at 5.5hpf, 6.5hpf and 7.5hpf time points in Cxxc1 and Kmt2b morpholino-injected conditions compared to control morpholino embryos (adj. p-value < 0.05). Zygotic genes = Gamete-Zygotic (GZ) + Zygotic-Specific (ZS). (F-G) Fold-change of gene expression levels of all zygotic genes in each group calculated over mean TPM of control morpholino technical replicates for (F) KEPT and (G) GAINED groups at the three time points. Statistical test: one-sided Wilcoxon rank-sum test; p-values: (****)<=0.0001, (***)<=0.001, (**) <= 0.01, (*)<=0.05; n.s. are p-values > 0.05. (H) Expression of zygotic genes in 3 technical replicates of every sample, clustered by H3K4me3 dynamics group (KEPT, GAINED and ABSENT). Fold-change of every gene is calculated over the mean TPM of three technical replicates of control morpholino of the respective time point. Genes are annotated by differential gene expression, and RNA dynamics group. (I) Fold change expression of pou5f3.2 and sox3 calculated over mean TPM of control morpholino replicates at two timepoints. (J) Quantification of survival phenotype. n=2 experiments, N>35 embryos per condition.

Article Snippet: The recommended standard control morpholino from Gene Tools LLC was used as a control.

Techniques: Western Blot, Knockdown, Injection, Control, Expressing

Journal: Cells

Article Title: An Anti-Invasive Role for Mdmx through the RhoA GTPase under the Control of the NEDD8 Pathway

doi: 10.3390/cells13191625

Figure Lengend Snippet: Mdmx and RhoA-dependent effect of MLN4924 treatment on Xenopus gastrulation. ( A ) Schemes of Xenopus embryo external morphology at four consecutive stages of gastrulation. The onset gastrulation is marked by the appearance of pigmented cells that outline the future blastopore (arrowhead). A flow of mesoderm internalisation is established (blue arrows), starting on the dorsal side and propagating all around to form the so-called blastopore lip. As internalisation progresses, the blastopore progressively shrinks. Its complete closure marks the end of gastrulation. ( B ) Representative images of five embryos per condition, from the same experiment, imaged at the mid–late blastula (stage 12). The embryos were oriented bottom-up to view the blastopore (arrows). Embryos were injected at the two cell stage with control morpholino (COMO), Mdmx-specific MO (MdmxMO), or mRNA coding for dominant negative RhoA N19 (dnRhoA). From blastula stage on, embryos were incubated in the presence of 20 μM MLN4924. Solvent DMSO (1/500) was used as negative control. Scale bar, 500 μm. ( C ) Quantification of relative blastopore area, normalised for each experiment to the average area of COMO-DMSO controls. Total number of embryos and number of independent experiments are indicated at the top of the graph. The coloured dots indicate the mean values for each experiment. Statistical comparison: non-parametric Anova (Kruskal–Wallis) followed by post hoc Dunn’s test. p -values, * < 0.05, ** < 0.01. ( D , E ) Examples of control and MLN4924-treated embryos at a late stage (tailbud). ( D ) The embryo has become thin and elongated (red double arrowhead). It is curved because still confined by the transparent egg shell. The anterior part (asterisk) shows well-defined head structures (purple arrow, optic anlage). ( E ) MLN4924-treated embryos show a typical phenotype resulting from moderately defective gastrulation. The embryo axis has remained much shorter, and the head structures are missing. Scale bar, 500 μm.

Article Snippet: Xenopus Mdmx morpholino (ATGCAAAGCAGTTGATGTAGACATG) and control morpholino (CCTCTTACCTCAGTTAACAATTTATA) were purchased from Gene Tools, LLC (Philomath, OR, USA).

Techniques: Injection, Control, Dominant Negative Mutation, Incubation, Solvent, Negative Control, Comparison